Key features and details | |
Cat. No. | MABL-2975 |
Name | Anti-ssDNA/dsDNA mAbs |
Clone No. | AFD- m3D8 |
From | Recombinant Antibody |
Isotype | Engineer antibody |
Application | hyrdolysis, SPR, ELISA |
Species Reactivity | Species independent |
Basic Information | |
Specificity | Binds unspecifically to double- and single-stranded DNA oligomers. |
Alternative Name | single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA |
UniProt | |
Immunogen | 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC |
Application Notes | This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease. |
Antibody First Published | Kim et al. 2006 Heavy and light chain variable single domains of an anti- DNA binding antibody hydrolyze both double- and single-stranded DNAs without sequence specificity. Journal of Biological Chemistry 2006; 281(22):15287-1595 PMID:16551636 |
Note on publication | Describes binding studies on mAB 3D8 on different types of oligos (ssDNA, dsDNA, dT:dA, dN:dN etc) using ELISA and SPR. |
COA Information (For reference only, actual COA shall prevail) | |
Size | 100 μg Purified antibody. |
Concentration | 1 mg/ml. |
Purification | Protein A affinity purified |
Buffer | PBS with 0.02% Proclin 300. |
Concentration | 1 mg/ml. |
Storage Recommendation | Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at - 20⁰C. |

